CDS

Accession Number TCMCG006C113662
gbkey CDS
Protein Id XP_013651190.2
Location join(4748398..4748760,4748876..4748941,4749113..4749118)
Gene LOC106355861
GeneID 106355861
Organism Brassica napus

Protein

Length 144aa
Molecule type protein
Topology linear
Data_file_division PLN
dblink BioProject:PRJNA293435
db_source XM_013795736.2
Definition probable mediator of RNA polymerase II transcription subunit 26a [Brassica napus]

EGGNOG-MAPPER Annotation

COG_category K
Description Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. The Mediator complex, having a compact conformation in its free form, is recruited to promoters by direct interactions with regulatory proteins and serves for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity). May play a role in transcription elongation (By similarity)
KEGG_TC -
KEGG_Module -
KEGG_Reaction -
KEGG_rclass -
BRITE -
KEGG_ko -
EC -
KEGG_Pathway -
GOs GO:0005575        [VIEW IN EMBL-EBI]
GO:0005622        [VIEW IN EMBL-EBI]
GO:0005623        [VIEW IN EMBL-EBI]
GO:0005634        [VIEW IN EMBL-EBI]
GO:0005654        [VIEW IN EMBL-EBI]
GO:0006139        [VIEW IN EMBL-EBI]
GO:0006351        [VIEW IN EMBL-EBI]
GO:0006354        [VIEW IN EMBL-EBI]
GO:0006366        [VIEW IN EMBL-EBI]
GO:0006368        [VIEW IN EMBL-EBI]
GO:0006725        [VIEW IN EMBL-EBI]
GO:0006807        [VIEW IN EMBL-EBI]
GO:0008023        [VIEW IN EMBL-EBI]
GO:0008150        [VIEW IN EMBL-EBI]
GO:0008152        [VIEW IN EMBL-EBI]
GO:0009058        [VIEW IN EMBL-EBI]
GO:0009059        [VIEW IN EMBL-EBI]
GO:0009987        [VIEW IN EMBL-EBI]
GO:0010467        [VIEW IN EMBL-EBI]
GO:0016070        [VIEW IN EMBL-EBI]
GO:0018130        [VIEW IN EMBL-EBI]
GO:0019438        [VIEW IN EMBL-EBI]
GO:0031974        [VIEW IN EMBL-EBI]
GO:0031981        [VIEW IN EMBL-EBI]
GO:0032774        [VIEW IN EMBL-EBI]
GO:0032991        [VIEW IN EMBL-EBI]
GO:0034641        [VIEW IN EMBL-EBI]
GO:0034645        [VIEW IN EMBL-EBI]
GO:0034654        [VIEW IN EMBL-EBI]
GO:0043170        [VIEW IN EMBL-EBI]
GO:0043226        [VIEW IN EMBL-EBI]
GO:0043227        [VIEW IN EMBL-EBI]
GO:0043229        [VIEW IN EMBL-EBI]
GO:0043231        [VIEW IN EMBL-EBI]
GO:0043233        [VIEW IN EMBL-EBI]
GO:0044237        [VIEW IN EMBL-EBI]
GO:0044238        [VIEW IN EMBL-EBI]
GO:0044249        [VIEW IN EMBL-EBI]
GO:0044260        [VIEW IN EMBL-EBI]
GO:0044271        [VIEW IN EMBL-EBI]
GO:0044422        [VIEW IN EMBL-EBI]
GO:0044424        [VIEW IN EMBL-EBI]
GO:0044428        [VIEW IN EMBL-EBI]
GO:0044446        [VIEW IN EMBL-EBI]
GO:0044451        [VIEW IN EMBL-EBI]
GO:0044464        [VIEW IN EMBL-EBI]
GO:0046483        [VIEW IN EMBL-EBI]
GO:0070013        [VIEW IN EMBL-EBI]
GO:0070449        [VIEW IN EMBL-EBI]
GO:0071704        [VIEW IN EMBL-EBI]
GO:0090304        [VIEW IN EMBL-EBI]
GO:0097659        [VIEW IN EMBL-EBI]
GO:1901360        [VIEW IN EMBL-EBI]
GO:1901362        [VIEW IN EMBL-EBI]
GO:1901576        [VIEW IN EMBL-EBI]

Sequence

CDS:  
ATGACATTAATGAAACCATCTGCTTCATTAGATACTTGGAGGGACTATTTTCGTCCAGGAGATTCTGATATCTTTGGGATCATCGAGCATGCCATAATGGTGGCTGACACTGATTCCCCAGAGGAGCTCAGATCCAGGAGATACACAATCGTCGAGCTTCTCTTCTCTTGTCAAGGGAGCCGCTGCATTGGATGTGACCAGCCCGATTTATCAAAATCTGGCGACAATGAGACCAACAATGGCCGTAAGACCATGGACACAGATGATGGTGCTCATGAAGAAGATGAGATGAAACTGAACAATAGTCAGATTGTTGATGAGGTCATGAGGATCAAAGATATCTTGTTAAACAAAAATGATGAGCCATCTGTGTTATTCGAATCCCTGAGAAATCTTACCTCCATGTCTATCACTCTGGATCTTATAAAGAGGTGA
Protein:  
MTLMKPSASLDTWRDYFRPGDSDIFGIIEHAIMVADTDSPEELRSRRYTIVELLFSCQGSRCIGCDQPDLSKSGDNETNNGRKTMDTDDGAHEEDEMKLNNSQIVDEVMRIKDILLNKNDEPSVLFESLRNLTSMSITLDLIKR